Információ

Fogadhat-e egy cella több másolatot egy betétből, ha különböző MOI-kat használ?

Fogadhat-e egy cella több másolatot egy betétből, ha különböző MOI-kat használ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Egy sejtvonalat akarok transzdukálni vírussal, amely egy adott inszertet hordoz.

Különböző fertőzési többszörösség (MOI) használatakor arra számítok, hogy a transzdukált sejtek különböző százalékát kapom, de lehetséges-e egynél több inszert integrálása a sejtgenomba? Magas MOI-t használok, és cellánként mindig 1 példányt kapok, így nem vagyok benne biztos, hogy ennek nagy növelése befolyásolhatja-e az integrált betétek számát.


Igen, ha elég magas MOI-t használ, akkor kettős fertőzést kaphat. Általában az 1 MOI-nál nagyobb érték garantálja a kettős fertőzés nagy esélyét. Ha magas MOI-értéket használ, és csak egyetlen inszerteket lát, ennek oka lehet, hogy sejtjeit nehéz transzfektálni. Ha megnézi ezt az oldalt: https://manuals.cellecta.com/lentiviral-construct-packaging-and-transduction/v10a/en/topic/lentiviral-titer-calculation, akkor általános referenciát kell adnia a kétszeres transzfektálás százalékára vonatkozóan sejteket kell látnia. A transzfektált sejtek és a MOI % közötti különbség 100%-os hatékonyságot feltételezve becsüli meg a dupla fertőzést.

Egyes sejtek kevésbé hatékonyak a transzfektálásban, és jó ötlet funkcionális titert szerezni a célsejtvonalon, ami nagyon egyszerű, ha a beilleszteni kívánt plazmidban van egy fluorofor.

Újraolvastam, mire gondolsz, és általánosan elfogadott, hogy a 0,4 alatti MOI nem ad kétszeres transzfekciót.


Sokoldalú, egylépéses CRISPR-Cas9 alapú megközelítés a plazmidok kikeményítéséhez

A plazmidok széles körben használatosak és alapvető eszközök a molekuláris biológiában. A plazmidok azonban gyakran metabolikus terhet jelentenek, és csak átmenetileg hasznosak génsebészeti, biológiai érzékelési és jellemzési célokra. Noha a genetikai manipulációra számos technika létezik, hiányzik egy univerzális eszköz, amely lehetővé tenné a plazmidok gyors eltávolítását a baktériumsejtekből.

Eredmények

A replikon bőség és a szekvencia konzervációs elemzése alapján kimutattuk, hogy a bakteriális klónozó és expressziós vektorok túlnyomó többsége szekvencia hasonlóságokat mutat, amelyek lehetővé teszik a széles körű CRISPR-Cas9 célzást. Összeállítottunk egy univerzális plazmid-keményítő rendszert (pFREE), és kifejlesztettünk egy egylépéses protokollt és PCR eljárást, amely lehetővé teszi a plazmidmentes klónok azonosítását 24 órán belül. Míg a megcélzott replikonok kontextusa befolyásolja a hatékonyságot, 40 és 100% közötti keményedési hatékonyságot értünk el az expressziós és mérnöki célokra legszélesebb körben használt plazmidok esetében. A CRISPR-Cas9 célzásnak köszönhetően platformunk nagymértékben bővíthető, és széles gazdakörnyezetben alkalmazható. A rendszerünk Gram-negatív baktériumokban való széles körű alkalmazhatóságát szemléltetjük azzal, hogy bemutatjuk mindkét esetben a sikeres alkalmazást. Escherichia coli és az ígéretes cellagyári alváz Pseudomonas putida.

Következtetés

Mint egy gyors és szabadon elérhető plazmid-keményítő rendszer, amely gyakorlatilag az összes klónozási és expressziós célokra használt vektort megcélozza, úgy gondoljuk, hogy a pFREE képes kiküszöbölni az egyéni vektor-öngyilkos megoldások szükségességét a molekuláris biológiában. Úgy gondoljuk, hogy a pFREE alkalmazása különösen hasznos több plazmidot magában foglaló, egymás után vagy egyidejűleg használt módszerekben, amelyek egyre népszerűbbek a genomszerkesztésben vagy a kombinatorikus útvonaltervezésben.


Kiegyensúlyozott sejtes és humorális immunválaszok, amelyek több antigént céloznak meg négyértékű inaktivált influenza vakcinát kapó felnőtteknél

Ennek a Preprintnek lektorált cikke is létezik.

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Kiegyensúlyozott sejtes és humorális immunválaszok, amelyek több antigént céloznak meg négyértékű inaktivált influenzaoltást kapó felnőtteknél. Védőoltások 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Kiegyensúlyozott sejtes és humorális immunválaszok, amelyek több antigént céloznak meg négyértékű inaktivált influenzaoltást kapó felnőtteknél. Oltóanyagok 2021, 9, 426. Másolat

Folyóirat hivatkozása: Vaccines 2021, 9, 426
DOI: 10.3390/vaccines9050426

Idézés mint:

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Kiegyensúlyozott sejtes és humorális immunválaszok, amelyek több antigént céloznak meg négyértékű inaktivált influenzaoltást kapó felnőtteknél. Védőoltások 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Kiegyensúlyozott sejtes és humorális immunválaszok, amelyek több antigént céloznak meg négyértékű inaktivált influenzaoltást kapó felnőtteknél. Oltóanyagok 2021, 9, 426. Másolat


Génszállítási stratégiák

Biolisztika

Biolisztika , a „biological ballistics” rövidítése és más néven részecske-közvetített géntranszfer, az a módszer, amellyel a DNS-fragmenseket közvetlenül a sejtekbe lövik a gén fegyvert.

A génfegyver használatához a tudós először összekever egy DNS-konstrukciót nehézfém-részecskékkel, általában wolframmal vagy arannyal. Ezek a finom részecskék a negatív töltésű DNS-hez tapadnak. A DNS/fém részecskéket egy műanyag golyó egyik oldalára töltjük (11.4. ábra). Nyomás alatt álló gáz, általában hélium, biztosítja az erőt a fegyver számára. A gáznyomás addig növekszik, amíg egy töréskorong el nem törik, és a műanyag lövedéket lenyomja egy tengelyen. A műanyag golyó hirtelen megáll a tengely végén, de a DNS/fém részecskék nagy sebességgel és erővel bújnak elő a fegyverből. Ha a fegyver biológiai szövetre irányul, a fémrészecskék egy része áthatol a sejtmembránokon, és DNS-konstrukciókat juttat a sejtekhez.

DNS-bevonatú fémrészecskéket helyeznek a golyó elülső végére. A nagynyomású gáz egy tengelyen hajtja le a golyót. A tengely végén a golyó blokkolva van, de a DNS-bevonatú részecskék nagy sebességgel és erővel bukkannak elő.

Egy idegtudós biolisztikai technológiát használhat arra, hogy hatékony génexpressziót idézzen elő az idegsejtekben. Ezzel a technológiával a Golgi-festéshez hasonló diszpergált transzfekciós mintázat hozható létre, amelyben csak az egyes sejtek kapják meg az idegen DNS-t a nem transzfektált sejtek hátterében. A biolisztikai technológia használatának másik előnye, hogy egy génpisztoly viszonylag vastag szöveten, például tenyészetben lévő szövetszeleten keresztül képes DNS-t szállítani. Ezért lehetséges olyan szeleten belüli sejteket transzfektálni, amelyeket más génbejuttatási módszerekkel nehéz lenne megcélozni. Ez a technika még nem járt sikerrel emlős neuronok transzfektálásában in vivo, bár használt in vivo máj- és bőrsejtek transzfektálására. A technológia használatának fő hátránya, hogy fizikai károsodást okozhat a sejtekben. Optimalizálásra van szükség a lövedékek becsapódási ereje által okozott szövetkárosodás mértékének korlátozása érdekében.


Vita

Az elmúlt néhány évtizedben a transzgénikus rágcsálómodellek hatékony eszközzé váltak a CRH neuronok agyi eloszlásának [15, 17, 19] és működésének [31,32,33,34] tanulmányozásában. A CRH neuronok egysejt felbontású morfológiai jellemzőinek vizsgálata érdekében a genetikai jelölést (transzgénikus egérvonalakat használva) kombináltuk az fMOST platformmal, hogy nagy felbontású képalkotó adatkészleteket hozzunk létre, amelyekkel jellemeztük a különböző CRH neuronok morfológiáját. különböző agyi régiók az egész egér agyában.

Az egyes riporter egérvonalak robusztus natív fluoreszcenciája lehetővé tette a jelölt neuronok finom dendrites és axonális struktúráinak közvetlen megjelenítését, amiről bebizonyosodott, hogy hasznos a neuronális áramkörök feltérképezésében, valamint specifikus sejtpopulációk képalkotásában és nyomon követésében [35,36, 37]. Összehasonlítottuk a fluoreszcensen jelölt CRH neuronok eloszlási mintázatát három riporter egérvonalban. Azt találtuk, hogy a felnőtt CRH-IRES-CreAi6 egerek mutatták a legtöbb jelölt neuront több agyi régióban (1J. ábra). Bár a három egérvonalat hasonló módon tervezték, az eredményeket a Cre-re való érzékenység és a fluoreszcens riporterek erőssége okozhatta. Az Ai6 riportervonalak érzékenyebbek a Cre alacsony szintjére, ami a Cre-pozitív populációk alaposabb azonosítását eredményezi [35], és könnyebben észlelhető a fokozottan fluoreszcens ZsGreen1 fehérje expressziója. Egy másik lehetséges magyarázat az, hogy a Cre-közvetített rekombináció több sejtben fordult elő az Ai14 vagy Ai32 riportervonalakban, de ez az alacsony riporterexpresszió miatt nem volt kimutatható. Nevezetesen, a fluoreszcens fúziós fehérje, a CHR2-EYFP membránhoz kötött, ezért a CRH-IRES-CreAi32 egerek neuronális folyamatainak plazmamembránja mentén oszlik el [38, 39], ami lehetővé teszi a teljes neuron morfológia egyértelmű megjelenítését. Ezért CRH-IRES-CreAi32 egereket használtunk a teljes agy képalkotásához és rekonstrukciójához. Érdekes módon nagyszámú EYFP-vel jelölt kérgi piramisneuront figyeltek meg felnőtt egerekben is (amelyről korábban nem számoltak be a születés utáni 21. nap kezdetétől) (1. további fájl, S3 ábra).

Ezt követően a rekonstruált neuronok elemzését főként számos stresszhez kapcsolódó régióra összpontosítottuk, beleértve az mPFC-t, a hipotalamusz, az amygdala, a BST és a hippocampus. Például arról számoltak be, hogy a helyi CRH-szintetizáló neuronok kiemelkedő szerepet játszanak a PFC-ben [8, 40, 41, 42, 43], és módosíthatják a piramis neuronok aktivitását [7]. Mindeddig azonban ritkán számoltak be a CRH neuronok teljes morfológiájáról az mPFC-ben. Itt rekonstruáltuk a fluoreszcens jelzett CRH neuronokat a PrL kérgi oszlopában az mPFC-n belül az 1-4 rétegeken keresztül (4A. ábra). Fontos, hogy a különböző idegsejtek típusait szómamélységük és arborizációs mintáik alapján osztályoztuk (példa a 4B. ábrán). Első alkalommal mutattuk be a különböző morfológiai típusú CRH neuronok eloszlását különböző kérgi rétegekben. Azt találtuk, hogy sűrű dendritek vannak (4A. ábra), dendrites duzzanatokkal (1. további fájl, S3 ábra, b) az 1. rétegben (amelynek a szómái a 2/3-ban vagy a 4-es rétegben helyezkedtek el), és hogy a rostok a kéreg felszínéig terjedtek. A rétegspecifikus dendritikus elhelyezkedések és különböző vetületi célpontjaik szerint a kéregben többféle feltételezett kapcsolódási mintát azonosítottak a CRH neuronok között (lásd a 4F-H ábrát). A kérgi CRH neuronok ilyen változatos dendrites kapcsolati mintázata a downstream kimeneti célpontok eltérő beidegzését tükrözheti (mindegyik felerősített alábra a 4F-H ábrán látható). Ezért a szomatikus elhelyezkedésük és a CRH neuronok egyedi lokális dendritikus morfológiájának jellemzésével jelen tanulmányunk nemcsak a CRH neuronok eloszlásának jelenlegi megértését javítja, hanem lehetővé teszi a jövőbeli tanulmányok számára a sejtspecifikus osztályozások további kidolgozását. Összességében ezek az eredmények segíthetnek a PFC morfológiailag változatos CRH neuronjainak jövőbeli funkcionális vizsgálatainak kidolgozásában.

Fontos, hogy a CRH neuropeptid hormonként működik, amelyet a PVN neuroendokrin neuronjai termelnek, és szabályozza a glükokortikoidok szintézisét és szekrécióját a mellékvesékből az adrenokortikotrop hormon hatására. Első alkalommal rekonstruáltuk a CRH neuronok érintetlen morfológiáját és a dendritekben található neurit varicositását (5E. ábra) a PaAp-ban (5A. ábra, B) és a Pe CRH neuronokban (5C., D. ábra). A PaAp-ban a legtöbb varicositású dendrit rostralisan vetült (5B. ábra), míg a Pe-ben a dendritek végei a harmadik kamráig terjedtek, és a nagy varicositások az ependimális sejtekhez tapadtak (5C–D, G ábra). Megállapítottuk továbbá, hogy ezek a dendritikus varicositások tartalmazzák a nagy sűrű vezikulum-asszociált fehérjét, a ChgB-t és az intracelluláris transzporthoz és kereskedelemhez használt molekuláris motorokat (például kinezineket). Érdekes módon számos varicositás a dendrit végén található, közel a harmadik kamrához vezető ependimális sejtek külső rétegéhez, amelyek ChgB immunpozitívak voltak (5G. ábra). Ezen túlmenően, nem voltak EYFP-vel jelölt CRH-rostok, amelyek az ependimális sejtekben oszlanak el, vagy nem haladtak át a sejteken. Ezek az eredmények arra utalnak, hogy a Pe-ben lévő CRH neuronok rostjai közvetlenül érintkeznek az ependimális sejtekkel, és az ependimális sejtek a 3. kamrába szabadulhatnak fel. Ezért feltételezzük, hogy ezek az endokrin CRH neuronok eltérnek azoktól, amelyek a középső eminenciára vetülnek, és hogy a CRH a dendritek által a hipotalamusz vagy a cerebrospinális folyadék más területeire is felszabadulhat, hogy részt vegyen annak szabályozó funkcióiban. Továbbá negatív korrelációt találtunk a szomatikus térfogat és a varicositasok száma között a PaAp-ban (5L. ábra). Így a dendritikus varicositások rekonstruált morfológiai jellemzői megkönnyíthetik a hipotalamusz CRH neuronjainak jövőbeni osztályozását (különböző rostorientáció és varicositás eloszlási minták szerint), és elősegíthetik potenciálisan változatos funkcióik megértését.

A rekonstruált CRH neuronok különböző agyi régiókban eltérő eloszlási mintázatot és morfológiát mutattak (3a-h ábra). Azt találtuk, hogy egyes neuronok közös bipoláris alakot mutattak az agy különböző régióiban (3i. ábra), különösen a hipotalamuszban (75% a PaAp-ban, 100% az SCN-ben) és a kéregben. Beszámoltak arról, hogy a parvocelluláris CRH neuroendokrin neuronok jellemzően két viszonylag vastag primer dendrittel rendelkeznek, amelyek bipoláris elrendezésben nyúlnak ki a szóma ellentétes oldalairól, és egyszer elágaznak [44, 45], továbbá a bipoláris sejtek gyakran megtalálhatók a kéregben [12, 46] , 47]. Így a CRH-reporter egereken végzett jelenlegi vizsgálatunk összhangban van ezekkel a korábbi tanulmányokkal, és ez az első, amely leírja ezen CRH neuronok specifikus idegi struktúráit, például a CRH neuronok közötti különböző típusú kapcsolatokat az mPFC-ben, valamint az ép neuronokat. dendritikus varicositások morfológiái hipotalamusz CRH neuronjaiban. Ezen CRH neuronok ilyen leegyszerűsített elágazási tulajdonságai a hipotalamuszban elősegíthetik endokrin funkciójukat. A különböző agyi régiókban rekonstruált CRH neuronok közül a szomamáik különböző méretűek voltak (3j. ábra), az LSD, VMPO és hippocampus szomamái nagyobbak, mint a PaAp, Pe és SCN szomatái. Ezenkívül eltérő dendrites ág-komplexitásokat találtunk ezekben a régiókban. Például az mPFC, LSD és hippocampus CRH neuronjai összetettebb dendritikus morfológiát mutattak, mint a PaAP, Pe és SCN neuronjai (3k–l. ábra). Hupalo et al. kimutatták, hogy a caudalis, de nem a rostrális dmPFC CRH neuronok kemogén aktiválása erősen károsította a munkamemóriát, míg ezen neuronok gátlása javította a munkamemóriát [29]. Ezenkívül a CRH a mediális septumban hat, és rontja a térbeli memóriát [48], és a BNST-ben hat, hogy részt vegyen a stressz által kiváltott maladaptív viselkedésekben [49]. A CRH funkciói azonban az OB-ban, az SCN-ben és a VMPO-ban továbbra is tisztázatlanok. Ezért jelenlegi tanulmányunk részletes morfológiai alapot nyújthat a jövőbeni funkcionális alapú vizsgálatokhoz a CRH neuronokkal ezekben a különböző agyi régiókban. Érdekes módon a PaAP, a Pe és az SCN mind a hipotalamuszban találhatók, és ezekben a régiókban a CRH neuronok kisebb szomájúak és gyakoribb bipoláris elágazási mintákat mutattak, mint a jelen tanulmányunkban elemzett más agyi régiókban. A PVN-ben a CRH neuronokat parvocelluláris sejtként azonosították [44, 50]. Azt találtuk, hogy a Pe-ben lévő CRH neuronok átlagos szomatikus térfogata nagyobb, mint a PaAP-ban lévő CRH neuronok átlagos térfogata (5H. ábra). Ezért feltételezzük, hogy ezek az adatok két különböző típusú CRH endokrin neuronra utalhatnak a hipotalamuszban. Összességében ezeknek a rekonstrukcióknak a kvantitatív elemzése a CRH neuronok régió-specifikus sokféleségét mutatja mind a szomatikus méret, mind az elágazás összetettsége tekintetében.

A dendrit tüskékről hagyományosan úgy gondolják, hogy nagyrészt hiányoznak a gátló neuronokból. Más csoportok korábbi tanulmányai és korábbi kutatásaink kimutatták, hogy a CRH neuronok GABAerg neuronok, amelyek számos különböző agyi régióban találhatók, mint például a kéregben [30] és a hippocampusban, továbbá a CRH neuronok általában aspinusok, míg néhány hosszú hatótávolságú projekció. A BST és a CeA CRH neuronjairól beszámoltak arról, hogy vannak tüskék [38]. Jelen tanulmányunkban a CRH neuronok dendrittüskéinek arborizációtól függő mintázatát mutattuk ki, ahol a legkifinomultabb típusú tüskék a kiterjesztett amygdalában (BST és CeA), a legegyszerűbbek pedig a hipotalamuszban (VMPO és SCN) találhatók. Érdekes módon, míg a tüskés GABAerg CRH neuronokat a BST-ben és a CeA-ban megerősítették, a aspiny CRH neuronokat ezeken a területeken is találtak.


VITA

Az itt bemutatott eredmények demonstrálják a többszínű genetikai jelölés erősségét és sokoldalúságát zebrahalban, és jól jellemzett eszközöket és validált módszereket kínálnak, amelyek könnyen alkalmazhatók. Az ubi: Zebrabow és UAS: Zebrabow vonalak széleskörű és szövetspecifikus többszínű jelölésre egyaránt alkalmasak: a szín hűen öröklődik a leánysejtek között, és idővel stabil, a szaruhártya és az előagytól a farokúszóig és a porcokig terjedő szövetekben pedig klónszerű struktúrák azonosíthatók. Mivel a különböző Zebrabow és Cre kombinációknak határozott előnyei vannak (2. és 3. táblázat), a kutatók a megközelítések széles skálájából választhatnak képalkotási igényeiknek megfelelően. Így a Zebrabow biztosítja a szükséges erőforrásokat a szisztematikus anatómiai és leszármazási vizsgálatokhoz a zebrahal fejlődése során.

A színstabilitás és a sokszínűség optimalizálása

Eredményeink azt mutatják, hogy a Zebrabow színei idővel stabilak maradnak. A színek azonban csak színképzés és érlelés után válnak stabillá. Először a Cre-t kell kifejezni, majd újra kell kombinálni a Lox-helyeket. Másodszor, a fluoreszcens fehérjekoncentrációnak el kell érnie az egyensúlyi állapotot. A nem alapértelmezett fluoroforoknak (CFP és YFP) időre van szükségük a felhalmozódáshoz, míg az alapértelmezett fluoroforoknak (RFP) időre van szükségük a lebomláshoz. Így a színérési sebesség a Cre rekombináció időzítésétől, a maradék RFP mennyiségétől, valamint az érett CFP és YFP felhalmozódásától függ. Az érési idő minimalizálásának egyik módja a Cre-közvetített rekombináció indukálása az RFP jelentős felhalmozódása előtt. A színstabilitás fenntartása érdekében az is lényeges, hogy a Cre tevékenység átmeneti legyen, hogy az RFP kifejezés ne változzon folyamatosan CFP-re vagy YFP-re.

A képalkotási körülmények a színstabilitást is befolyásolják. A különböző fluoreszcens fehérjék eltérő fotostabilitási profillal, gerjesztési és emissziós spektrummal rendelkeznek, és képesek ellenállni a rögzítésnek (Shaner et al., 2008 Shaner et al., 2005 Weissman et al., 2011). Ezek a tényezők befolyásolhatják a színt a minta-előkészítés és a képalkotás után. Például a mélyebb szövetekben a hosszabb hullámhosszú (az RFP által kibocsátott) fény kevésbé lesz szórva, mint a rövidebb hullámhosszúságú fény. A felületesebb struktúrákra összpontosítottunk, mert a 200-300 μm-es mélységen túli képalkotás továbbra is kihívást jelent. Érdekes lesz megvizsgálni, hogy a mikroszkópos vagy szövettisztítási technikák közelmúltbeli fejlődése javítja-e a Zebrabow képalkotást a mélyebb struktúrákban (Hama et al., 2011 Kaufmann et al., 2012 Keller et al., 2008 Kuwajima et al., 2013). Az intenzív lézergerjesztés a három fluorofor relatív arányát is torzíthatja, mivel az RFP és a CFP kevésbé fotostabil, mint az YFP (Weissman et al., 2011). Eredményeink azt mutatják, hogy a Zebrabow képes stabil színeket generálni, de a színek kialakítását és stabilitását empirikusan kell tesztelni.

A színdiverzitás egy másik fontos változó a többszínű képalkotásban. A nagy színdiverzitás minden sejtet jobban nyomon követhet, és csökkenti annak az esélyét, hogy a különböző klónok azonos színűek legyenek. Eredményeink azt mutatják, hogy a Zebrabow színprofilok előre látható pályán változnak, válaszul a növekvő Cre-szintre és aktivitásra. Amíg a Cre aktivitás hangolható (hősokkkal vagy tamoxifennel), lehetséges az optimális színdiverzitás létrehozása. Azt is megállapítottuk, hogy a rekombináción átesett sejtek száma a Cre aktivitás növekedésével növekszik. A rekombináció kevesebb sejtben megy végbe alacsony színdiverzitás mellett, és több sejtben nagy diverzitású körülmények között. Azokban az alkalmazásokban, ahol ritka címkézésre és nagy színdiverzitásra van szükség, a transzplantációs megközelítések (pl. ubi: Zebrabow vad típusba) használható a jelölési sűrűség csökkentésére (az adatok nem láthatók).

Klonális elemzések

Tanulmányunk azt mutatja, hogy a Zebrabow számos szövetben képes klonális elemzésre, beleértve a szaruhártya, az agy, az izom, a porc és az érrendszert. A klónszerű klaszterek sokfélesége a különböző szervekben az organogenezis során a progenitor expanzió különböző módjait sugallja. Például a nagy kohéziós klaszterek jelenléte nem csak egy kis progenitor sejthalmaz gyors proliferációjára utal, hanem a leánysejtek korlátozott eloszlására is a származási helyükről. A sejtek viselkedésének ilyen vonatkozásai könnyen tanulmányozhatók az itt használt technikákkal.

A feltételezett klónok nem csak a kohéziós klaszterek közös színei alapján azonosíthatók, hanem a színek is felhasználhatók annak meghatározására, hogy a diszpergált sejtek lehetnek-e klonális rokonok. Összehasonlítva az egyszeres vagy kettős címkézéssel, a Zebrabow színeinek sokfélesége csökkenti annak valószínűségét, hogy a nem kapcsolódó sejtek azonos színűek legyenek. A hasonló színű sejtek kiterjedt elterjedése azonban akadályozhatja a klonális kapcsolatok egyértelmű hozzárendelését. A klónok azonosításának egyik módja az egyszínű klónonkénti (klónméret) sejtek számának összehasonlítása különböző jelölési sűrűség mellett: ha az azonos színű sejtek klónosan rokonok, a klón mérete a jelölési sűrűségtől függetlenül azonos lesz. Ezzel szemben, ha sok nem rokon sejtnek ugyanaz a színe, a klón mérete a jelölési sűrűséggel nő. Ilyen számításokat végeztek retrovirális klonális analízisben, és színanalízisre is alkalmazhatók (Galileo et al., 1990).

A szaruhártyában régóta úgy gondolják, hogy az epiteliális őssejtek kizárólag a limbusban helyezkednek el, és a szaruhártya klónjai a limbus centripetális növekedésével jönnek létre (Davies és Di Girolamo, 2010 Lavker et al., 2004). Érdekes módon az új bizonyítékok arra utalnak, hogy a szaruhártya őssejtek szétszóródhatnak a szaruhártya egészén, és a szaruhártya klónjai centrifugális, nem pedig centripetális növekedéssel képződhetnek (Majo et al., 2008). Azt találtuk, hogy sok zebrahal szaruhártya klónja a perifériás szaruhártya-ból származik, amely a limbushoz hasonló régió. Bár eredményeink nem zárják ki annak lehetőségét, hogy a klónok egy részhalmaza a szaruhártya központi részéből származhat, az egyes klónok time-lapse képalkotása arra utal, hogy a szaruhártya klónok a limbus eredetű klónok centripetális expanziójával jönnek létre. Ezek az eredmények azt mutatják, hogy az itt leírt Zebrabow erőforrás ideálisan alkalmas az organogenezis és a szöveti homeosztázis alapvető kérdéseinek megoldására.


A CRISPR segítségével az új technika megkönnyíti a genetikai hálózatok feltérképezését

Kredit: CC0 Public Domain

A CRISPR-Cas9 megkönnyíti egyetlen gén kiiktatását vagy módosítását, hogy meghatározza annak hatását egy szervezetre vagy sejtre, vagy akár egy másik génre. De mi lenne, ha egyszerre több ezer kísérletet hajthatna végre a CRISPR segítségével a genom minden génjének egyenkénti módosítására, és gyorsan láthatná mindegyik hatását?

A Kaliforniai Egyetem (Berkeley) tudóscsoportja egy egyszerű módszert dolgozott ki ennek érdekében, amely lehetővé teszi, hogy bárki profilt készítsen egy sejtről, beleértve az emberi sejteket is, és gyorsan meghatározza a genomban található összes DNS-szekvenciát, amely egy adott gén expresszióját szabályozza.

Míg a technika leginkább azoknak az alapkutatóknak lesz hasznára, akik érdeklődnek a genetikai tevékenység kaszkádjának – a genetikai hálózatnak – nyomon követésében, amely hatással van az őket érdeklő génre, segít a kutatóknak abban is, hogy gyorsan megtalálják a betegségek génjeit irányító szabályozó szekvenciákat, és esetleg megtalálják. új célpontok a kábítószerekkel kapcsolatban.

"Egy olyan betegség, ahol érdemes ezt a megközelítést alkalmazni, a rák, ahol ismerünk bizonyos géneket, amelyeket ezek a rákos sejtek expresszálnak, és expresszálniuk kell a túléléshez és növekedéshez" - mondta Nicholas Ingolia, az UC Berkeley molekuláris és sejtszakértő professzora. biológia. "Ez az eszköz lehetővé tenné, hogy feltedd a kérdést: Mik azok az upstream gének, melyek azok a szabályozók, amelyek szabályozzák azokat a géneket, amelyekről tudunk?"

Ezeket a vezérlőket könnyebb lehet terápiásan megcélozni a rákos sejtek leállítása érdekében.

Az új technika leegyszerűsít valamit, amit eddig nehéz volt megtenni: vissza kell lépni egy sejtben a genetikai útvonalak mentén, hogy megtalálják ezeket a végső vezérlőket.

"Sok jó módszerünk van a továbblépésre" - mondta. "Ez egy jó módja annak, hogy visszafelé dolgozz, hogy kitaláljuk, mi van valami előtt. Úgy gondolom, hogy sok lehetséges felhasználása van a betegségkutatásban."

"Néha azt a hasonlatot használom, hogy amikor bemegyünk egy sötét szobába, és megfordítjuk a villanykapcsolót, láthatjuk, hogy milyen világítás kapcsol be. Ez a fény olyan, mint egy gén, és meg tudjuk mondani, ha megfordítjuk a kapcsolót, milyen géneket okoz. Ebben már nagyon jók vagyunk" - tette hozzá. "Ez lehetővé teszi számunkra, hogy visszafelé dolgozzunk. Ha van egy lámpánk, ami fontos számunkra, szeretnénk megtudni, melyek azok a kapcsolók, amelyek vezérlik. Ez lehetőséget ad erre."

Ryan Muller, az Ingolia laboratórium végzős hallgatója, valamint kollégái, Lucas Ferguson és Zuriah Meacham, valamint Ingolia december 10-én teszik közzé technikájuk részleteit online a folyóiratban. Tudomány.

A CRISPR-Cas9 génszerkesztés nyolc évvel ezelőtti megjelenése óta a kutatók, akik meg akarják határozni egy adott gén működését, képesek voltak a Cas9 fehérjével pontosan megcélozni és kiiktatni azt. A gén DNS-ével komplementer irányító RNS-szel vezérelve a Cas9 fehérje a génhez kötődik, és elvágja, vagy ahogy a CRISPR interferenciánál (CRISPRi) is, gátolja azt.

A legdurvább típusú vizsgálatban a sejt vagy szervezet vagy él, vagy meghal. Azonban meg lehet keresni a kiütés finomabb hatásait, például azt, hogy egy adott gén be vagy ki van-e kapcsolva, vagy mennyire van felfelé vagy lefelé.

Ma ehhez egy riportergént kell hozzáadni – gyakran egy zöld fluoreszcens fehérjét kódolót –, amely a promóter azonos másolatához kapcsolódik, amely elindítja az Önt érdeklő gén expresszióját. Mivel minden gén egyedi promotere határozza meg, hogy az adott gén mikor fejeződik ki. , ha a Cas9 kiütése befolyásolja a kívánt gén expresszióját, ez hatással lesz a riporter expressziójára is, így a kultúra zölden világít fluoreszkáló fényben.

Mindazonáltal, mivel az élesztőben összesen 6000 gén található – és az emberekben összesen 20 000 gén –, nagy vállalkozás minden egyes gén módosítása és a fluoreszcens riporterre gyakorolt ​​hatás felfedezése.

"A CRISPR megkönnyíti a genomban lévő összes gén átfogó felmérését és megzavarását, de a nagy kérdés az, hogy hogyan lehet kiolvasni az egyes zavarok hatásait?" ő mondta.

Ez az új technika, amelyet Ingolia CRISPR interferencia vonalkódolt expressziós riporter szekvenciával vagy CiBER-seq-nek nevez, megoldja ezt a problémát, lehetővé téve ezeknek a kísérleteknek egyidejű elvégzését több tízezer CRISPR-kísérlet összevonásával. A technika megszünteti a fluoreszcenciát, és mély szekvenálást alkalmaz a készletben lévő gének megnövekedett vagy csökkent aktivitásának közvetlen mérésére. A mély szekvenálás nagy áteresztőképességű, régóta olvasott következő generációs szekvenálási technológiát használ az egyesített mintákban kifejezett összes gén szekvenálására és lényegében megszámlálására.

"Egyetlen összevont CiBER-seq kísérletben egy nap alatt megtalálhatjuk az összes upstream szabályozót több különböző célgénhez, míg ha fluoreszcencia alapú technikát használna, akkor ezeknek a céloknak mindegyike több napos mérést igényelne. ideje – mondta Ingolia.

A szervezet minden génjének párhuzamos CRISPR-beállítása egyszerű, köszönhetően azoknak a cégeknek, amelyek kész, egyetlen vezető RNS-eket árulnak a Cas9 fehérjével való használatra. A kutatók a genom minden génjéhez rendelhetnek sgRNS-t, és minden génhez egy tucat különböző sgRNS-t – a legtöbb gén több ezer nukleotidból álló lánc, míg az sgRNS körülbelül 20 nukleotid hosszúságú.

A csapat kulcsfontosságú újítása az volt, hogy minden sgRNS-t egy egyedi, véletlenszerű nukleotid szekvenciával – lényegében egy vonalkóddal – kapcsoltak össze, amely egy promoterhez kapcsolódik, amely csak akkor írja át a vonalkódot, ha a kérdéses gén is be van kapcsolva. Minden vonalkód egy sgRNS hatásáról számol be, külön-külön megcélozva egy gént a több ezer sgRNS-ből álló komplex készletből. A mély szekvenálás megmutatja a mintában lévő minden vonalkód relatív mennyiségét – élesztő esetében körülbelül 60 000 –, ami lehetővé teszi, hogy gyorsan felmérje, hogy az élesztőben található 6000 gén közül melyik van hatással a promóterre, és így a kérdéses gén expressziójára. Emberi sejtekbe a kutató több mint 200 000 különböző irányító RNS-t illeszthet be, minden gént többször megcélozva.

"Valójában ez a lényege annak, amit másként tudtunk csinálni: az az elképzelés, hogy van egy nagy könyvtárad különböző vezető RNS-ekből, amelyek mindegyike más-más gént zavar meg, de ugyanaz a lekérdezéspromoter van rajta – a A lekérdezés-promoter átírja azt a véletlenszerű vonalkódot, amelyet az egyes útmutatókhoz kapcsolunk" - mondta. "Ha van olyan válasz, amely érdekli, akkor minden egyes gént beledöfög a genomba, és meglátja, hogyan változik a válasz."

Ha például egy olyan vonalkódot kap, amely 10-szer gyakrabban fordul elő, mint bármelyik másik, az azt jelzi, hogy a lekérdezés-promoter 10-szer erősebben van bekapcsolva abban a cellában. A gyakorlatban Ingolia körülbelül négy különböző vonalkódot csatolt minden egyes vezető RNS-hez, az eredmények négyszeres ellenőrzéseként.

"Ha közelebbről megvizsgáljuk a génexpressziós választ, nagyon sok finomságot ismerhetünk fel magával a fiziológiával kapcsolatban, hogy mi történik a sejtben" - mondta.

Az újonnan jelentett kísérletekben a csapat öt különálló gént kérdezett meg az élesztőben, köztük az anyagcserében, a sejtosztódásban és a sejt stresszre adott válaszában részt vevő géneket. Noha lehetséges lehet akár 100 gén egyidejű tanulmányozása is, amikor a teljes genomot CRISPR-ben vizsgálják, gyanítja, hogy a kényelem kedvéért a kutatók egyszerre négyre vagy ötre korlátoznák magukat.


Géntechnológia az élelmiszerekben: A zsűri még mindig nem áll rendelkezésre

Az élelmiszerekben a géntechnológia felhasználható javított gyümölcsök, zöldségek és élelmiszernövények előállítására. De ezt felelősséggel kell kezelni. Olvassa el ezt a BiologyWise cikket, hogy felfedezze az élelmiszerek géntechnológiájának világát.

Az élelmiszerekben a géntechnológia felhasználható javított gyümölcsök, zöldségek és élelmiszernövények előállítására. De ezt felelősséggel kell kezelni. Olvassa el ezt a BiologyWise cikket, hogy felfedezze az élelmiszerek géntechnológiájának világát.

A génsebészet az élőlények génjeinek közvetlen manipulálásával foglalkozik. Ennek eléréséhez olyan technikákat alkalmaznak, mint a molekuláris klónozás és transzformáció. With the help of these techniques, the genetic structures and characteristics of a life form can be altered.

Szeretne nekünk írni? Nos, jó írókat keresünk, akik szeretnék terjeszteni az igét. Vedd fel velünk a kapcsolatot és megbeszéljük.

Ban ben molecular cloning, a DNA sequence is isolated and its multiple copies are obtained. This technique is often used in the amplification of DNA sequences. In the átalakítás technique, a change is brought about in the genetic structure of a cell by introducing a foreign DNA into it.

A segment of DNA is a protein sequence. By changing this sequence, different versions of that protein can be obtained. Until now, genetic engineering has been successfully applied for the improvement of crops and in the manufacture of medicines to a certain extent. It has been used in the alteration of genes in organisms to develop improved versions of the species.

How are genetic engineering techniques used to modify crops?

  • The most common method is of using a gene gun to introduce genes into plant cells. DNA bound to particles of gold or tungsten are shot into the plant tissue or cells, under high pressure. The particles penetrate the cell wall and membranes, DNA separates from the metal and integrates itself in the plant DNA inside the nucleus.
  • In the Agrobacterium tumefaciens-mediated technique, Agrobacteria introduce their genes into plant hosts.
  • In case of electroporation, DNA enters plant cells through small pores created by electric pulses.
  • In microinjection, genes are injected into the DNA.

Genetic engineering to introduce new traits in plants, can lead to increase in their yield, improve agricultural practices, and improve the nutritional value of food. Plants tolerant to weed killers, allow farmers to kill weeds without worrying about the crops. The advantages of herbicide or insecticide-resistant crops are similar. The future of genetically engineering crops could be the development of edible vaccines. Development of potatoes with edible vaccines for diarrhea, and cultivation of tobacco with antibodies for dental caries, is in the stage of pre-clinical human trials.

Out of the three important cereals namely wheat, rice, and corn, wheat was the last to be transformed genetically. Recombinant DNA techniques were used to create the first transgenic wheat around the 1980s.

Biotechnology is the term used for genetic engineering in food. As the name suggests, it is a technology based on biology. It deals with agriculture, medicine, and food science. Before 1971, this term was used in relation with the agriculture and food processing industries.

By the use of genetic engineering, genes can be transferred to a developed variety of crop to achieve a higher yield. The transfer of genes which impart the characteristic of greater yield, is critical. But it is also one of the most beneficial applications of genetic engineering in food. With the help of genetic engineering techniques, certain desirable traits are introduced in crops, which include pest resistance, improvement in the crop’s nutrient profile, or resistance to environmental conditions and chemical treatments.

An antibiotic-resistant tobacco plant cultivated in 1982 was the first genetically modified crop. Field trials to produce insect-resistant tobacco plants occurred for the first time in the USA and France. China was the first country to allow the use of transgenic plants.

Szeretne nekünk írni? Nos, jó írókat keresünk, akik szeretnék terjeszteni az igét. Vedd fel velünk a kapcsolatot és megbeszéljük.

Biotechnology can be used to improve the nutritional value of foods. This is indeed an application of great potential. Along with the improvement in nutrition, a better taste can be imparted to foods by engineering them genetically. This requires the use of biotechnology to slow down the process of food spoilage. It can result in the production of fruits and vegetables that have a longer shelf life. Perishability of foods can be reduced to a great extent, thus giving a boost to the agriculture and food industry.

Paradicsom were the first food crop with an edible fruit where it was possible to insert genetic material in the cell’s chloroplast and chromoplast plastomes. They have been genetically engineered to study fruit ripening. Those with an antifreeze gene were developed to make them frost-tolerant. They were tested to improve their tolerance to cold and drought. They have been altered to develop resistance to bacterium Bacillus thuringiensis and to improve their nutrient profile and taste.

Recently, researchers have identified a plant gene called At-DBF2, which when transferred to tomato and tobacco cells, increases their endurance to harsh soil and climatic conditions. It is often seen that certain types of soils or climatic conditions in certain regions, are the reasons for less growth of the crops there. This limitation can be overcome by genes that impart a withstanding capacity to crops. Similarly, it is good if genetic engineering can reduce the dependability of crops on fertilizers. It can make the plants tolerant to herbicides and resistant to harmful insects and pests.

In 1999, the first virus-resistant papayas were commercially grown in Hawaii. The University of Hawaii started developing a papaya cultivar resistant to Papaya Ringspot virus. Viral genes encoding capsid proteins were transferred to the papaya genome. The proteins generate an immune response-like reaction, making the papaya immune or unsusceptible to the ringspot infection. Genetically modified papayas are approved for consumption in the USA and Canada, but not in the European Union.

Genetic engineering can be used to produce new substances such as proteins or other nutrients in food. Foods can be genetically modified to increase their medicinal value. Researchers see edible vaccines as a potential use of genetic engineering in food. This will give rise to homegrown vaccinations and easily available medicines. The costs incurred in their transportation and other costs involved will substantially reduce, leading to cost-effectiveness in medications. Corn has been engineered to produce pharmaceuticals.

Certain corn strains are genetically engineered to introduce desirable traits in them. Cultivars resistant to glyphosate herbicides were brought into commercial use in Monsanto in the year 1996. This corn variety was called the Roundup Ready Corn. Liberty Link corn variety, resistant to glufosinate was developed by Bayer CropScience.

Maize has been genetically modified to express proteins from the bacteria Bacillus thuringiensis, which is poisonous to certain insect pests. This corn variant is known as Bt corn. Lately, corn varieties resistant to ear worms and root worms have been developed. In 2013, drought tolerance was introduced into corn. These corn hybrids were known as DroughtGard and were produced in Monsanto.

This Isn’t True!

You may come across images like these, but the cross of apples with oranges is not a reality. Oranges cannot cross produce with apples as the two belong to different species. Their crossing would require gene splicing, which is difficult. Heard of the phrase ‘mixing apples and oranges’? Idiomatically, it means mixing two totally different things. And scientifically speaking too, apples and oranges nem tud be genetically combined.

Criticism

The darker side of genetic engineering in food is that the processes involve the use of herbicides and contamination of genes in crops. Horizontal gene transfer and recombination can give rise to new pathogens. It may introduce virulency among pathogens. If certain resistance genes spread in the harmful bacteria themselves, we may waste our defenses to diseases. By genetically engineering food, we are in a way ignoring the possibility that transgenic life forms could be harmful.

Genetically engineered crops may supersede natural weeds. Genetic engineering in food may prove to be dangerous to other weeds and natural organisms. The self-replication of genetically modified life forms might render us helpless in controlling their production and growth.

If not done with great care, genetic engineering can have negative side effects on food. It can lead to undesirable mutations in genes. It may produce allergies in crops. Moreover, in case of genetically modified seeds, all of them are identical in their genetic structure. This might cause a widespread failure of a crop due to a pest attack. Some argue that in refining the appearance and taste of food, its nutritional value may be compromised.

This makes us realize that the seemingly rosy picture of genetic engineering in food may prove to be thorny too. Genetic engineering should be used with responsibility. High standards should be exercised to ensure safety in the genetically engineered foods. The bottom line is that before we introduce genetic alterations in food, we should have a clear understanding of their dangers. Failing to understand the negative aspects of genetic modification of foods, may pose a risk to our health and safety.

Related Posts

Learn some genetic engineering ethics when it comes to practices like cloning, that are in the eyes of many, immoral and a perverse attack on creation.

Genetic engineering process manipulates the DNA sequence to create a new one. The write-up focuses on the various benefits of genetic engineering.

Of late, there has been great debate over the process of human cloning. Whether it is ethical or unethical, genetic cloning is always seen as the greatest challenge in genetic&hellip


Can a cell receive multiple copies of an insert when using different MOIs? - Biológia

The Science of Biotechnology

Discovering and Developing Medicines

How Are Biotech Medicines Made?


The Science of Biotechnology

Biotechnology has been used in a rudimentary form since ancient brewers began using yeast cultures to make beer. The breakthrough that laid the groundwork for modern biotechnology came when the structure of DNA was discovered in the early 1950s. To understand how this insight eventually led to biotech therapies, it&rsquos helpful to have a basic understanding of DNA&rsquos central role in health and disease.


Illustration is copyrighted material of BioTech Primer, Inc., and is reproduced herein with its permission.

What does DNA do?
DNA is a very long and coiled molecule found in the nucleus, or command center, of a cell. It provides the full blueprint for the construction and operation of a life-form, be it a microbe, a bird, or a human. The information in DNA is stored as a code made up of four basic building blocks, called nucleotides. The order in which the nucleotides appear is akin to the order of the letters that spell words and form sentences and stories. In the case of DNA, the order of nucleotides forms different genes. Each gene contains the instructions for a specific protein.

With a few exceptions, every cell in an organism holds a complete copy of that organism&rsquos DNA. The genes in the DNA of a particular cell can be either active (turned on) or inactive (turned off) depending on the cell&rsquos function and needs. Once a gene is activated, the information it holds is used for making, or &ldquoexpressing,&rdquo the protein for which it codes. Many diseases result from genes that are improperly turned on or off.


Mód

DNA Constructs and Reagents

BAC Clones RP23-412o5 and RP23-395m11 were obtained from Children's Hospital Research Institute (CHORI). BACLink -GM and -SP linking vectors were generously provided by Claire Huxley [10]. pLD53-SCAEB recombination vector was generously provided by Shiaoching Gong [8] and the mini lamda vector was generously provided by Donald M. Court [19]. Homology Arms were amplified using Pfx DNA polymerase (Invitrogen) and amplified using an icycler (Biorad).

Cloning Homology Arms into BACLinking Vectors

Trap homology arm 3 was amplified using oligos SPA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and SPA3 3'TRAP (TCTCGGATCCTTCTGTCGACGGCAGAGGCAGGCGGATTTTGAGTT) containing a BamH1 and internal Sal1 site. Homology arm 3 was digested with Xho1/BamH1 and cloned into the Sal1/Bamh1 site of BacLink-SP using conventional cloning practices. Dmp1 homology arm 2 was amplified using the oligos SPA2 5'DMP (TCTCGTCGACCATCTATTTATACAATTGCTCACTGAG) containing a Sal1 site and SPA2 3'DMP (TCTCGGATCCCTCTATTATAAACTGCTGTGTGTCTAAG) containing a BamH1 site and subsequently cloned into the Sal1/BamH1 site of BacLink SP-TRAP-A3 to create BACLink SP-TRAP/DMP A3/A2. Ibsp homology arm 1 was amplified using the oligos SPA1 5'IBSP (TCTCCTCGAGGTCCTTTCTACAATACTTAGAAACTTAAGT) containing an Xho1 site and SPA1 3'IBSP (TCTCACGCGTTCTATTGGTAACCTGCCATTTTCCCTTAGA) containing a Mlu1 site. Arm1 was then cloned into the Mlu1/Xho1 site of BACLink SP-TRAP/DMP A3/A2 to create BACLink SP-TRAP/DMP/IBSP. This vector was then used to capture a genomic DNA fragment containing the genes DMP1 és IBSP described below. TRAP homology arm 4 was amplified using the oligos GMA4 5'TRAP (TCTCGTCGACTGGCACGTGGGATAAGTCTATGCATGT) containing a Sal1 site and GMA4 3'TRAP (CTCTGGATCCCAGTAGCTACCACTTGCTGGTTTTGAG) containing a BamH1 site and cloned into the Sal1/BamH1 site of BACLink-GM to create BACLink-GM TRAP-A4. TRAP homology arm 3 was amplified using oligos GMA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and GMA3 3'TRAP (TCTCACGCGTGGCAGAGGCAGGCGGATTTTGAGTTCA) containing an Mlu1 site and cloned into the Xho1/Mlu1 site of BACLink-GM TRAP-A4 to create BACLink-GM TRAP-A3/A4. This vector was subsequently used to capture a genomic DNA region of the TRAP gén.

Subcloning Genes into BAC Linking vectors

RP23-412o5 and RP23-395m11 containing DH10B were made electrocompetent and transformed with mini lamda [19]. Colonies were selected for on Chloramphenicol (12.5 ug/ml) and Tetracycline (10 ug/ml) LB Agar plates and grown at 32c. Resistant colonies were expanded and made electrocompetent. To prepare electrocompetent cells containing mini lamda, cells were maintained at 32c, but at the end of the growth phase were heat shocked at 42c for 15 minutes to activate the Red Recombinase System. BACLink SP TRAP/DMP/IBSP was double digested with Not1/SacI and transformed into RP23-395m11/mini lamda bacteria and selected for on spectinomycin (50 ug/ml) resistant LB Agar plates. BACLink GM TRAP A3/A4 was digested with Xho I and transformed into RP23-412o5/mini lamda bacteria and selected for on gentamicin (5 ug/ml) resistant plates. Recombinants were initially screened by colony PCR where oligos were designed flanking homology arms, one being present in the vector and the other being present on the other side of the homology arm. A DMP1/IBSP genomic DNA fragment oligos SP2 (GCCCTACACAAATTGGGAGA) and DMPR (ACTCTTTCCTTAAAGATATCAATTTAC) were used to screen the DMP1 end and Belo2658 (TTTGTCACAGGGTTAAGGGC) and IBSPR (TCTGCTGATGTGTCCACCAGCACTAAG) were used to screen the IBSP vége. A TRAP genomic DNA fragment oligos Belo 2658 and TRAP-A3R (AATTACAGATTTGTGAGATAGTCACAC) were used to screen the arm 3 end and GM5'end (CGTAACATCGTTGCTGCTGCGTAACAT) and TRAP-A4R (CCGCAGATGGACTTCTGTCCAGCTGAG) were used to screen the arm 4 end. Potential BAC subclones positively identified by PCR were further verified by restriction digested followed by FIGE.

Cloning of Homology Arms into pLD53 Vectors

Homology Arms were cloned into pLD53 Vectors using standard cloning practices. Homology arms were PCR amplified using PFX polymerase from RP23-412o5 and RP23-395m11 BAC clones. Two homology arms were amplified for each gene (referred to as arms A, B, C, D, E, & F). Primer sequences are as follows: TRAPBox E5'Mlu (TCTCACGCGTGAAGTCCAGTGCTCACATGAC), TRAPBoxE3' Not (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG), TRAPBoxF5'PAC1 (GTGCTTAATTAAGCGCTGACTTCATCATGTCTC), TRAPBoxF3'PAC1 (GTGCTTAATTAAGACATACACACAGACACACAC), IBSPBoxA5'Mlu (TCTCACGCGTCTGTGAAGTATTCAAGGTACTC), IBSPBoxA3'NHE (CTAGCTAGCTGCAATTTCTTCTG CAATTGAAG), IBSPBoxB5'BSIW1(GATCGTACGGACTGCTTTAATTTTGCTCAGC), IBSPBoxB3'PAC1 (GTGCTTAATTAATATCACTGGCTCTACTGTCAGTC), DMP1BoxCMlu (TCTCACGCGTGCTTCTGAG TTGGTGGAGAGATAC), DMP1BoxC3'NHE1(CTAGCTAGCGGATGCGATTCCTCTACCTGTAATGAAAG), DMP1 BoxD5'BSIW1/Cla1 (CATCGTACGATCGATGACTGTCATTCTCCTTGTGTTCC) DMP1BoxD 3'BSIW1(GATCGTACGGGATCGTAGTTCATACTACTTAC) Amplified products were run through a PCR clean up column (Qiagen), restriction digested and gel purified (Zymogen). Plasmids were digested and then briefly treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs) followed by phenol chloroform extraction and precipitation. Vector and inserted were mixed, ligated at room temperature for 1 hour and electroporated into PIR2 cells. Transformants were selected on LB plates with ampicillin (50 ug/ml).

Inserting Fluorescent Proteins into Genes

After cloning in homology arms A and B, 1 ug of pLD53 was electroporated into 40 ul of electrocompetent bacteria containing the BAC clone of interest. Bacteria were grown for 1 hour in SOC media by shaking at 37c without antibiotic selection. The entire transformation suspension was plated onto LB plates with the appropriate antibiotics (ampicillin 50 ug/ml, gentamicin 5 ug/ml, spectinomycin 50 ug/ml). Ten colonies were picked and re-streaked onto a new plate and grown overnight. The next morning the ten colonies were grown in 1 ml LB media containing the appropriate antibiotic. When bacteria growth appeared, 50–100 ul of LB was taken to screen for an arm A recombination event by colony PCR. PCR primers were designed to flank the A homology arm. Gene specific sense primers were: TRAPrecomA (ACACATTACCATCAGACCCTG), IBSPrecomA (GTCTGATACCTCCGAAGAGCTCAC), DMP1recomA (GTTAGGTTGCTGTGTAATACTGGC). Fluorescent protein antisense primers were: CT genotype (GTTTACGTCGCCGTCCAGCTCGACCAGGAT) for ECFP and Topaz fluorescent proteins and mCherry genotype (GCACCTTGAAGCGCATGAACTCCTTGATGA) for mCherry fluorescent protein. The rest of the bacteria culture was grown to confluence and minipreps were carried out. BAC clones were digested with Sal I to verify integration of pLD53 vector (pLD53 introduces a SalI site). Two positive integrants as determined by colony pcr and FIGE were further processed for backbone resolution. Two colonies from each clone were picked from the original re-streaked plate and grown for one hour with shaking in LB media without ampicillin, but in the presence of gentamicin or spectinomycin. 10–100 ul of media was spread onto TG plates and grown overnight at 37c. 40 colonies were picked and replated onto LB plates containing the appropriate antibiotic (no amplicillin). To enrich for resolved clones gentamicin/ampicillin or spectinomycin/ampicillin plates were also used as a replica of the 40 clones. Small colonies were favored over larger colonies when picking clones. Twenty ampicillin sensitive colonies were grown initially screened by colony PCR to verify the presence of the fluorescent protein reporter. Diagnostic restriction digests and FIGE was further carried to verify the genomic integrity of the clones and confirm pLD53 backbone resolution. Moreover, primers flanking the B homology arm were also used in combination with recomBoxA oligos to confirm resolution: TRAPrecomB (CATAATCTGTCCTCTGGCCTG), IBSPrecomB (GAACAGCTGGCTGACAGCACTGAATCAAC), DMP1recomB (TCCAGTTACACCACATAG GAATTG).

Linking Genes of Interest

The bacteriophage Red recombinase system was introduced into BACLink-SP containing DMP1-mCherry and IBSP-Topaz reporter genes by transformation of mini lamda and bacteria cells were made electrocompetent as described above. 10 ug of BACLink-GM TRAP-ECFP was digested with I-PPO1, phenol/cholorform extracted, precipitated, and resuspended in TE. 2 ug of digested BAC was transformed into competent bacteria containing SP-DMP1mCherry/IBSP-Topaz. Transformed colonies were selected for on LB gentamicin plates (5 ug/ml). Clones were initially screen by PCR using primers BL-TRAP (ACAGATTTGTGAGATAGTCACACAATTC) and BL-DMP1 (GACAATGTTTGCAGACTATGAATGAAG) that flank the linked genomic region. PCR positive clones were further verified by diagnostic restriction digest.

Generation of Transgenic Animals

The linked BAC construct was purified from 250 mls of bacteria culture using a large construct kit (Qiagen). 10 ug of BAC was linearized with I-PPO1 restriction enzyme for 2 hours and was further purified on a CL-4B sepharose (Sigma) column that was pre-equilibrated with injection buffer (10 mM Tris pH7.5, 0.1 mM EDTA, 100 mM NaCl). Twelve 200 ul fractions were collected and BAC DNA was quantified using a pico green DNA assay (Molecular Probes) and/or using a Nanodrop spectrophotometer (Thermoscientific). Pronuclear injection was carried out at the UCONN Health Center Gene Targeting and Transgenic Facility (GTTF).

Preliminary Transgenic Characterization

For imaging of transgene expression in spine, 6 week old females were sacrificed in accordance with our animal care protocols and tissues were dissected and fixed in 4% paraformaldehyde for 4 days, decalcified in 28% sodium free EDTA for 5 days, immersed in 30% sucrose/1 mM MgCl2 for 1 day. Decalcified tissue was frozen embedded and cryosectioned on to cryofilm type IIC tape (Finetec). Sections were imaged on a Zeiss Z.1 Observer inverted microscope. Filter sets used for imaging were purchased from Chroma Technology and are as follows: (HQ500/20 Ex, HQ 535/30 Em, Q515lp beam splitter) for Topaz (YFP), (D436/20 Ex, D480/40 Em, Q455dclp beam splitter) for ECFP, (HQ577/20 Ex, HQ640/40 Em, Q595lp beam splitter) for mCherry. TRAP staining was carried out after imaging bone sections with for ECFP using the Acid Phosphatase Kit (Sigma).

Estimating Transgene Copy Number

Tails were clipped from three animals of each mouse line and wild type animals. Genomic DNA was prepared using a DNAeasy Blood and Tissue Kit (Qiagen) and real time PCR was carried out on an I-Cycler (Biorad) for the Trap gene 5'TRAP (GTCTGTGGAACTGACGGCTGTAGATGGCTA) 3'TRAP (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG) and normalized to the Biglycan gene 5'-Biglycan (CAGAGCTTACACCCACTAACATACTC) 3'-Biglycan (CTCCGAAGCCCATAGGACAGAAGTCA).

Fold difference of transgenic mouse lines was compared to wild type CD1 mice and transgene copy number was estimated based on this fold difference.



Hozzászólások:

  1. Alvis

    Őszintén köszönöm a segítséget.

  2. Riocard

    Köztünk mondjuk, meg kell próbálnia megnézni a google.com webhelyet

  3. Kip

    Nagyon mulatságos információ

  4. Hotah

    I'm sorry, nothing I can not help you. But I am sure you will find the right solution.

  5. Averill

    Nincs igazad. Biztos vagyok benne. Beszéljük meg. Írj PM-et, megbeszéljük.

  6. Alcides

    Also worries me about this issue, where can I find more information on this topic?



Írj egy üzenetet