Információ

1.6: DNS-sablon előkészítése mutáns RNS-szenzor szintézishez restrikciós endonukleáz használatával - Biológia

1.6: DNS-sablon előkészítése mutáns RNS-szenzor szintézishez restrikciós endonukleáz használatával - Biológia


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

6.1 Tanulási cél

Ebben a laborban megkapja a mutáns szenzor RNS-t tartalmazó DNS-sablonunkat, amely készen áll az RNS-szintézisre. Ezzel a folyamattal megtudhatja, hogy a restrikciós endonukleázok – egy adott szekvenciánál DNS-t hasító enzimek – hogyan érik el rendkívüli specifitását.

6.2 Mini projekt folyamatábra

Az alábbi folyamatábra vastagon szedett blokkja kiemeli az aktuális kísérlet szerepét a mini projektben.

6.3 Szinopszis

A mini projekt célja az volt, hogy a toxinszenzorban olyan nukleotidokat azonosítsanak, amelyek elengedhetetlenek a tetraciklin antibiotikum felismeréséhez. E cél felé való törekvés során azonosítottad az evolúciósan konzervált elemeket az érzékelőben, és módosítottad azokat. Primereket tervezett az érzékelő szekvenciájának megváltoztatására, és mutáns szenzor-DNS-eket készített PCR-amplifikáció és plazmid-előkészítés segítségével. Annak teszteléséhez, hogy ezek a mutáns szenzorok képesek-e felismerni a tetraciklint, meg kell szintetizálni a mutáns szenzor RNS-eit. Emlékezzünk vissza, a szenzor egy RNS-molekula, de szekvenciája a genomban van kódolva DNS-szinten. Az RNS-t lineáris DNS-templát és RNS-polimeráz segítségével szintetizálják. Ezért a mutáns szenzort kódoló plazmid DNS-t restrikciós endonukleáz segítségével le kell vágni (linearizálni). A plazmidvektort a toxinérzékelő szekvencia végén hasítják, hogy megakadályozzák, hogy az RNS-polimeráz a teljes plazmidvektort RNS-vé írja át (csak az érzékelőre van szüksége). Az RNS-polimerázok hasonlóan működnek, mint a DNS-polimerázok, és a következő laborban többet megtudhat róluk.

6.4 Hogyan működnek a restrikciós endonukleázok?

A restrikciós endonukleáz úgy fejlődött ki, hogy hasítsa a behatoló DNS-t, de a gazdaszervezet DNS-ét érintetlenül hagyja. Molekuláris biológusok széles körben használják eszközként a plazmid specifikus hasítására, ill in vitro szintetizált DNS-t a klónozás során. A restrikciós endonukleázok olyan enzimek, amelyek a dsDNS-t egy specifikus szekvenciában, milliószoros specifitással hasítják. Ez azt jelenti, hogy a restrikciós endonukleázok milliószorosan előnyben részesítik célszekvenciájukat más szekvenciákkal szemben. Rokon DNS-ek meghatározott szekvenciával rendelkeznek, és hatékonyan hasadnak, míg nem rokon DNS-ek nem rendelkeznek a specifikus szekvenciával, ezért a restrikciós enzim nem hasítja őket hatékonyan. A restrikciós enzimek fémaktivált vízmolekulát használnak nukleofilként. A fémhez kötött vízmolekula savasabb, mint egy normál vízmolekula. Ezért a fémhez kötött víz könnyebben elveszíti protonját és hidroxilcsoporttá válik. A hidroxilcsoport erős nukleofil, és nagyon hatékonyan képes katalizálni a foszfodiészter kötés hasítását (6.1. ábra).

6.5 Hogyan érnek el a restrikciós enzimek milliószoros specifitást?

A restrikciós endonukleázok a rokon szekvenciájukat milliószor előnyben részesítik más szekvenciákkal szemben. Hogyan érhető el ez a rendkívüli sajátosság? A restrikciós endonukleáz hasítási helyek kettős szimmetriával rendelkeznek. Hasonlóképpen, a restrikciós enzimek dimerek, és komplementer kettős szimmetriával rendelkeznek (6.2. ábra).

A restrikciós endonukleáz kiterjedtebb H-kötő hálózatot képez rokon DNS-ével, mint nem rokon DNS-ével. Ennek eredményeként a rokon DNS meggörbül (a dsDNS szerkezetében megtört) és a olló kötés (a kötés, amely elhasad) az enzim aktív helyének kellős közepébe kerül a hasításhoz. A rokon DNS hajlításához szükséges energia a restrikciós enzim és a rokon DNS közötti kiterjedt H-kötésből származik.6.3. ábra; 6.4. ábra).

6.6 Hogyan ítéljük meg, hogy a plazmid DNS sikeresen linearizált-e?

Az agaróz gél elektroforézis egy hatékony technika a DNS méret és/vagy alak alapján történő elkülönítésére (lásd 5. fejezet). Mivel a mutáns szenzor-RNS-t kódoló plazmid DNS-t baktériumok szintetizálták, az szupertekercs és kompakt. Ha ezt a DNS-t egy restrikciós endonukleázzal felvágják, bemetsződik, és így megnyúltabb lesz. Ennek eredményeként a szuperspirált (vágatlan) plazmid DNS messzebbre vándorol az agaróz gélben, mint a linearizált (vágott) DNS. Ha a DNS linearizálása sikeres, a vágott DNS-t tartalmazó mintában egyetlen sávnak kell lennie, amely kevésbé vándorol a gélben, mint a vágatlan DNS-minta (6.5. ábra).

6.7 Mit fogunk csinálni a laborban?

Először megemészti a mutáns toxinérzékelőt kódoló plazmid DNS-t a BamHI restrikciós enzimmel, és értékelje a reakció sikerességét agaróz gélelektroforézis segítségével. Amíg a gél fut, fenol-kloroform extrakcióval eltávolítja a restrikciós enzimet, és etanolos kicsapással növeli a DNS-koncentrációt.

JEGYZŐKÖNYVEK

A reagens- és felszerelésigényt hat diákcsapatra számítjuk. ~20% többlet van benne.

Felszerelés/üvegáru szükséges

  1. Három 100 ml-es dugós Erlenmeyer-lombik
  2. Három 100 ml-es mérőhenger
  3. Három készlet mikropipetta (20-100 μl és 2-20 μl)
  4. Gél dokumentációs rendszer
  5. Vízfürdő (a restrikciós emésztéshez) 37 °C-ra állítva
  6. Harminc 1,5 ml-es centrifugacső (Eppendorf)
  7. 1 mikrocentrifuga, 10 000 g-ig

Megoldások szükségesek

  1. 3 l 1 x TAE (trisz-acetát-EDTA) pH=8,0
  2. 30 ml 1%-os EtBr vagy azzal egyenértékű nukleinsav festés
  3. 20 ml agaróz gél töltőfesték (6x, Biorad)
  4. 30 ml 1 kb molekulatömegű létra (Biorad)
  5. 2 ml fenol:klórform:izoamil-alkohol keverék
  6. 150 ml 3 M Na-acetát, pH=5,2
  7. 1,5 ml izopropanol

A pUC19-ykkCD plazmid vektor restrikciós emésztése

A csapat minden tagja emésztést végez

Keverje össze a következő oldatokat egy centrifugacsőben

  1. 5 μl puffer 3 (New England Biolabs)
  2. 5 μl 1 mg/ml szarvasmarha szérum albumin oldat
  3. 5 μl BamHI restrikciós enzim (New England Biolabs)
  4. 75 μl plazmid DNS

Inkubáljuk 37 °C-os vízfürdőben 1 órán át.

Agaróz gél elektroforézis

  1. Mérjünk le 1 g agarózt, és helyezzük a mellékelt dugaszolt Erlenmeyer-lombikba.
  2. Adjon hozzá 100 ml 1xTAE puffert egy mérőhenger segítségével.
  3. Melegítse 1 percig mikrohullámú sütőben, forgassa a lombikot, és rövid ideig hűtse le víz alatt.
  4. Adjunk hozzá 10 μl EtBr-t. (Viseljen kesztyűt. Az EtBr mutagén.) Forgatólombik a keveréshez.
  5. Öntsön folyadékot a gélkazettába, és helyezze el a fésűket. Körülbelül 20 percet vesz igénybe az agarózgél megkötése.
  6. Miután a gél megkötött, töltse fel a mintákat egy molekulatömeg-létrával. A gélt 20 percig 100 V-on kell futtatni.
  7. Készítsen képet a gélről egy géldokumentációs rendszer segítségével.

Helyezze az alábbi minták 5 ml-ét 1 ml töltőfestékkel keverve az agaróz gélre

  1. Molekulasúly marker
  2. Plazmid DNS a plazmid prep-ből (vágatlan DNS minta)
  3. Restrikciós endonukleázokkal emésztett plazmid DNS (vágott DNS)

Fenol-kloroformos extrakció és etanolos kicsapás

  1. Adjon hozzá 100 μl fenol/kloroform keveréket a mintához.
  2. Vortex 20 másodpercig.
  3. Centrifugálja 2 percig mikrocentrifugában maximális sebességgel.
  4. Dobja el az alsó réteget. (Ez a lépés eltávolítja a restrikciós endonukleázt tartalmazó szerves réteget.)
  5. Adjunk hozzá 100 μl kloroformot, keverjük össze és centrifugáljuk az előzőek szerint. Távolítsa el az alsó réteget. Ez a lépés eltávolítja a maradék fenolt.
  6. Adjon hozzá 10 μl 3 M NaAc-ot és 100 μl izopropanolt a keverékhez.
  7. Vortexelje a mintát és tegye -20 ºC-os fagyasztóba a kicsapódáshoz.

Megjegyzések az oktatónak

A 6. fejezetben található kísérlet célja, hogy megtanítsa a diákoknak, hogyan hajtsák végre a pUC19-ykkCD plazmidvektor enzimatikus hasítását BamHI restrikciós enzim segítségével. Ugyanez a protokoll minimális módosításokkal használható eltérő DNS-sel és/vagy restrikciós endonukleázzal. A BamHI restrikciós enzimet a New England Biolabs-tól vásároltuk, de más gyártók is használhatók. Két diákcsapat megosztott egy agaróz gélt, hogy korlátozza a felszerelési igényt, miközben maximalizálja ennek a fontos technikának való kitettségét. Ha a felszerelések száma korlátozott, hat diákcsapat könnyedén megoszthat egy agaróz gél készüléket. Mivel a restrikciós endonukleáz emésztés egy órát vesz igénybe, célszerű a laboratóriumi munkamenetet a reakciók beállításával és a laboratórium előtti előadásokkal kezdeni, miközben a reakciók futnak. Ebben a laboratóriumban két szünet van, amíg az agaróz gél megköt és fut. Ezek az idők felhasználhatók a restrikciós endonukleáz vagy elektroforézis munkalap kitöltésére.

Előlaboratóriumi kérdések a DNS-linearizáláshoz

Határozza meg a következő fogalmakat.

  1. Restrikciós endonukleáz

  2. Ollós kötés

  3. Rokon DNS és nem rokon DNS

  4. A DNS minőségének teszteléséhez a DNS-mintát agaróz gélen kell feloldani. Agaróz gél készítéséhez és futtatásához 1 l 1 x TAE pufferre (Tris-acetate EDTA) van szüksége. Ön 40 x koncentrált TAE pufferkészletet vásárolt. Írja le, hogyan készíti el a gélhez szükséges 1 l 1 x TAE oldatot (mutassa be a számítását).

Laboratóriumi jelentés vázlata és pontelosztás

1. Több mondat, amely meghatározza a kísérlet célját. Ismertesse ennek a kísérletnek a jelentőségét a mini projekten belül. (3 pont.)

2. Röviden definiálja/leírja a restrikciós endonukleázt. Magyarázza el, hogyan érhető el a specifikusság. (4 pont.)

3. Mellékelje az agaróz gél szkennelés másolatát a minták megjelölésével. (4 pont)

4. Jelentse a plazmid DNS koncentrációját. (2 pont)

5. Értékelje a plazmid DNS-hozamot a DNS-koncentráció alapján (hány mg DNS-t kapott). Mutassa be a hozamszámítást, és írja meg, milyen jó volt a DNS-hozam. (6 pont.)

6. Értékelje a plazmid DNS tisztaságát az agaróz gél szkennelés és az UV abszorbancia alapján meghatározott 260/280 leolvasás alapján. Magyarázd el. (6 pont.)

7. Ítélje meg DNS-linearizálásának sikerességét az agaróz gél szkennelés alapján. (4 pont.)

8. Határozza meg a plazmid DNS méretét, feltéve, hogy a DNS lépcsős létra méretei: 1000 bp, 2000 bp, 3000 bp, 4000 bp, 5000 bp, 6000 bp, 7000 bp, 8000 bp, 9000 bp,00 bp. (4 pont.)

9. Elektroforézis feladatkészlet (17 pont)

A restrikciós endonukleázok nagyon specifikusak, és specifikus nukleotidszekvenciáknál hasítják a DNS-t. Amikor ezek az enzimek nagy DNS-re hatnak, az sok-sok különböző méretű fragmentumra bomlik. Az ilyen fragmensek méret szerinti eloszlása ​​minden egyes DNS esetében alapvetően egyedi. Ez az elosztás egy DNS „ujjlenyomatot” biztosít, amely minden egyén egyedi. A DNS-ujjlenyomatokat a genetikai mutációk azonosítására, az öröklődő tulajdonságok nyomon követésére, a származás megállapítására és a gyanúsítottak bűncselekmény helyszínére történő elhelyezésére használták.Számos különböző technika létezik, amelyek DNS-ujjlenyomatot eredményeznek. Az alábbi problémák némelyike ​​a technikákat írja le, és az eredmények értelmezését kéri.1. (3 pont) Több ezer különböző restrikciós endonukleáz létezik, mindegyiknek megvan a maga specifitása. Például a BamHI, EcoRI és XhoI a következő jellemzőkkel rendelkezik (a hasítási helyek nyilakkal vannak jelölve):Azonosítsa a hasítási helyeket a következő DNS-en (jelölje meg mindegyik helyet egy vonallal és a specifikus endonukleáz nevével):5'CCCGAGGATCCTTAGGAATTCATCTA3'3'GGGCTCCTAGGAATCCTTAAGTAGAT5'2. (4 pont) Mutassa be a BamHI hasításból származó termékfragmensek szekvenciáját! Miért mondják, hogy ezek a termékek „ragadós végűek”?3. (6 pont) A restrikciós fragmentumhossz polimorfizmus (RFLP, gyakran ejtsd: „riflip”) a DNS-ujjlenyomat-vétel legrégebbi formája. Ez attól függ, hogy az egyes egyedekből származó DNS-nek számos egyedi szekvenciájú szegmense van. Minden szegmensnek sokféle szekvenciája lehet, amelyek örökölhetők. Ezt a tulajdonságot „polimorfizmusnak” nevezik. A polimorfizmus azt jelenti, hogy minden egyed DNS-e különböző restrikciós enzim hasítási helyekkel rendelkezik. Röviden, az RFLP magában foglaljaA DNS kezelése specifikus restrikciós endonukleázzal;A kapott fragmenseket méret szerint szétválasztjuk agaróz gélen;Specifikus fragmensek megjelenítése komplementer DNS-próbák segítségével.A származás megállapításához a következő agaróz gélt használtuk. Egy lókuszú RFLP segítségével hozták létre. Ez azt jelenti, hogy a használt próba csak a DNS egy polimorf szegmensére volt érzékeny.Az eredmények értelmezéséhez tudnia kell– Minden egyed két DNS-kópiát hordoz, és ez azt jelenti, hogy minden DNS-szegmenshez két különböző polimorfizmus tartozik;– Minden egyén minden szülőtől egy DNS-másolatot örököl.http://www.biology.arizona.edu/)a. Vannak olyan gyerekek, akik nem úgy tűnik, hogy ezek a szülők biológiai gyermekei? Magyarázd el.b. Mi kell, hogy igaz legyen a gyermek DNS-ujjlenyomatára ahhoz, hogy megállapítható legyen, rokoni kapcsolatban áll-e az anyával és az apával?4. (4 pont) A következő DNS-ujjlenyomatokban a C/AF Mix egy olyan sáv, amely az állítólagos apa DNS-ét, valamint a gyermek DNS-ét egyaránt tartalmazza.(A Genelex Corporation jóvoltából)Az apaság mindkét esetben bizonyított? Röviden magyarázza el.5. (6 pont) A PCR-t RFLP-vel kombinálták a DNS-ujjlenyomat érzékenységének növelése érdekében. Ebben a technikában a PCR egy specifikus DNS-szegmenst amplifikál. Ezután az RFLP azonosítja a szekvencia változásait.Például a sarlósejtes vérszegénység diagnosztizálható ezzel a technikával. A sarlósejtes vérszegénységet a hemoglobin fehérjeláncok egyikét kódoló DNS egyetlen mutációja okozza. Ez a mutáció egy restrikciós endonukleáz hasítási helyet is megszüntet az enzim számára; Cvn. A hasítási hely elvesztése ekkor diagnosztikus a sarlósejtes gén számára.A következőkben egy anyát, egy apát és egy gyermeket vizsgáltak meg a sarlósejtes génre DNS-ujjlenyomat segítségével. Az elektroforézisminta feletti diagram a szülőket (I. sor) és a gyermekeket (II. sor) mutatja. A nőstényeket egy kör, a hímeket pedig egy négyzet szimbolizálja. A normál gént nyitott szimbólum jelzi, a sarlósejtes gént pedig a kitöltött szimbólum. (Ne feledje, hogy minden egyén a gén két példányát hordozza.)Minden egyén szimbóluma egy sávnak felel meg az elektroforézis gélben. A sávok szintén „S”-vel vannak jelölve a sarlósejtes mutáció jelenlétére, és „A”-val a normál gén jelenlétére. (A DNS-létra a jobb oldalon található, és bázisok számában van megadva. Vegye figyelembe, hogy a gél „fejjel lefelé” áll – a kisebb töredékek közelebb vannak a tetejéhez.)(Dr. Carole Ober jóvoltából)Becsülje meg a hasítási fragmentumok méretét, amelyek csak a sarlósejtes mutáció nélküli egyedben vannak jelen. Röviden indokolja választását.Melyik sávból származnak ezek a hasítási töredékek? Be tudod azonosítani a zenekart és megbecsülni a méretét? Magyarázza meg az érvelését.A kutató ezen elektroforézis alapján diagnosztizálta ezeket az alanyokat (SS, AS vagy AA). Lát-e ellentmondást a diagnózisban? Röviden magyarázza el.

Tervezzünk primereket a hagyományos (kivágás és beillesztés) mutagenezishez, hogy az ykkCD toxinérzékelőt a pUC19 klónozó vektorba helyezzük. Az ehhez hasonló kísérletek általában az első lépést jelentik egy fehérje vagy RNS laboratóriumi vizsgálatában. A toxinérzékelő szekvenciáját és a klónozó vektor térképét az alábbiakban adjuk meg.Az ykkCD szenzor DNS-szekvenciája:TgtaaagttttctagggttccgcatgtcaattgacatggactggtccgagagaaaacacatacgcgtaaatagaagcgcgtatgcacacggagggaaaaaagcccgggagagA pUC19 klónozó vektor térképeAz ykkCD toxin érzékelőt a pUC19-be kell beilleszteni a klónozó vektor egy részének, amelyet többszörös klónozóhelynek vagy polilinker MCS-nek neveznek. A klónozó vektor ezen része több restrikciós enzim számára tartalmaz vágott helyeket, és úgy tervezték, hogy lehetővé tegye a DNS-szekvencia beépítését. A pUC19 esetében elérhető restrikciós enzimek: EcoRI, SacI, KpnI, SmaI, BamHI stb.Az ykkCD szekvencia pUC19-be történő beillesztésének befejezéséhez válaszoljon az alábbi kérdésekre:1. A hagyományos klónozási projekt első lépése az, hogy a polilinker MCS-ben lévő restrikciós enzimek közül válasszunk párat, amelyek nem hasítják el a kívánt szekvenciát (az ykkCD szenzort). Az ykkCD szekvenciát hasító restrikciós enzimek nem használhatók klónozáshoz, mert elhasítanák a kérdéses szekvenciát, és nem tennék lehetővé a teljes szekvencia beillesztését a klónozó vektorba. A megfelelő restrikciós endonukleázok kiválasztásához kövesse az alábbi két lépést.a. Illessze be az ykkCD érzékelő sorrendjét a Webcutter nevű programba (http://www.firstmarket.com/cutter/cut2.html). Sorolja fel azoknak a restrikciós enzimeknek a nevét, amelyek nem vágják el az ykkCD szekvenciát!b. Az MCS polilinker mely enzimei használhatók a klónozási projekt végrehajtásához? Adjon rövid magyarázatot.2. Tervezzen primereket a klónozási kísérlet végrehajtásához.a. Adja meg a felső és alsó primer szekvenciákat. Röviden magyarázza el, hogyan tervezte ezeket az alapozókat. A DNS melyik részéhez kapcsolódnak ezek a primerek? Ne feledje, van különbség a Quickchange és a hagyományos PCR között.b. Számítsa ki a T-tM (olvadáspont) minden alapozóhoz. Használhatja az Oligo kalkulátort (http://www.basic.northwestern.edu/biotools/oligocalc.html) a T előrejelzéséreM.c. A hagyományos PCR-hez egy speciális szekvencia hozzáadása szükséges, amelyet minden egyes restrikciós enzim felismer, amelyet restrikciós helynek neveznek. Az egyes restrikciós enzimek felismerési szekvenciája megtalálható a http://www.neb.com oldalon.A felülvizsgált primer szekvenciáknak ezt a mintát kell követniükRestrikciós hely szekvencia + primer szekvencia a „b”-től.d. Írja fel mindkét primer sorrendjét 5'-3' irányban.


Nézd meg a videót: Ribonukleinska kiselina - RNK (Június 2022).


Hozzászólások:

  1. Tremain

    Brilliant sentence and on time

  2. Nelrajas

    In my opinion, this is a delusion.

  3. Echa

    Szerintem igazad van

  4. Cus

    Ó, magyarázd el, kérlek, különben nem nagyon mentem be a témába, milyen?

  5. Pranav

    the very curious question



Írj egy üzenetet